View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2188_low_15 (Length: 238)
Name: NF2188_low_15
Description: NF2188
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2188_low_15 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 197; Significance: 1e-107; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 18 - 230
Target Start/End: Complemental strand, 9071770 - 9071559
Alignment:
| Q |
18 |
agggcaagttcaaacatcaagttgttgcttagatgatgatgatttgaagaaaaaaggattctcaggtttctctctcttgataagacaccgttcattactt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9071770 |
agggcaagttcaaacatcaagttgttgcttaggtgatgatgatttgaagaaaaaaggattctcaggtttctctctcttgataagacaccgttcattactt |
9071671 |
T |
|
| Q |
118 |
gaatgcagattttctaattgcagataatccaaatcaattttcatgcatttcatgctattcttcaactttagtgtcactcattctgatttctgtcataaga |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
9071670 |
gaatgcagattttctaattgcagataatccaaatcaattttcatgcatttcatgctattcttcaactttagtgtcactcattcttatttctgt-ataaga |
9071572 |
T |
|
| Q |
218 |
ttttggttatcat |
230 |
Q |
| |
|
||||||||||||| |
|
|
| T |
9071571 |
ttttggttatcat |
9071559 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 163 - 232
Target Start/End: Complemental strand, 9068844 - 9068775
Alignment:
| Q |
163 |
catttcatgctattcttcaactttagtgtcactcattctgatttctgtcataagattttggttatcatat |
232 |
Q |
| |
|
||||||||| ||||||||||||||||| |||||||||||||||||||| |||||||||| |||||||||| |
|
|
| T |
9068844 |
catttcatgatattcttcaactttagtttcactcattctgatttctgtaataagattttcgttatcatat |
9068775 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University