View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2188_low_7 (Length: 367)
Name: NF2188_low_7
Description: NF2188
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2188_low_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 161; Significance: 9e-86; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 161; E-Value: 9e-86
Query Start/End: Original strand, 18 - 259
Target Start/End: Complemental strand, 4337607 - 4337367
Alignment:
| Q |
18 |
gctttgtggtctgaagacttgggatctaggagcgtgctcttctctaggtatcgaatttgaattccccaagtaccaaaaattcttgtgttgggcccaatgg |
117 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4337607 |
gctttgtggtgtgaagacttgggatctaggagcgtgctcttctctaggtatcgaatttgaattccccaagtaccaaaaattcttgtgttgggccgctcc- |
4337509 |
T |
 |
| Q |
118 |
agatacaaagctttgttcttgtagcaattggggccccc-gctagtggttagtgggatttatccccc-ggattagttggtccttaggccggatatggagtt |
215 |
Q |
| |
|
||||||||||||||||| |||||||||||| ||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
4337508 |
--atacaaagctttgttctggtagcaattgggcccccccgctagtggttagtgggatttatccccccggattagttggtccttaggccggatatggagtt |
4337411 |
T |
 |
| Q |
216 |
ttcaagagnnnnnnntcagctcaaattaaaatttacctggcaag |
259 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
4337410 |
ttcaagagaaaaaaatcagctcaaattaaaatttacctggcaag |
4337367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 313 - 350
Target Start/End: Complemental strand, 4337313 - 4337276
Alignment:
| Q |
313 |
aaatcatctgcaggctctacttgaagagagatcctctt |
350 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4337313 |
aaatcatctgcaggctctacttgaagagagatcctctt |
4337276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University