View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2189_low_11 (Length: 234)

Name: NF2189_low_11
Description: NF2189
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2189_low_11
NF2189_low_11
[»] chr8 (1 HSPs)
chr8 (1-221)||(1022416-1022636)


Alignment Details
Target: chr8 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 1022416 - 1022636
Alignment:
1 aaaaatggttattttgaattaaatgcagaaatagtttatcactctagtaatatactgagcaaagtgagctcaacttggacctctaagccaccattagcag 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1022416 aaaaatggttattttgaattaaatgcagaaatagtttatcactctagtaatatactgagcaaagtgagctcaacttggacctctaagccaccattagcag 1022515  T
101 ttaaataccggttcgacgctggttcacttgaaggaccgggtggtccaaagagcctctgctcaactttggaccggcttttggcatgggaaaacaaactctt 200  Q
    |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1022516 ttaaataccggttcgacgctggttcacttgaaggaccgggcggtccaaagagcctctgctcaactttggaccggcttttggcatgggaaaacaaactctt 1022615  T
201 tcaggaagtgaaggtgagttt 221  Q
    |||||||||||||||||||||    
1022616 tcaggaagtgaaggtgagttt 1022636  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University