View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2189_low_12 (Length: 225)
Name: NF2189_low_12
Description: NF2189
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2189_low_12 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 84 - 120
Target Start/End: Complemental strand, 3521533 - 3521497
Alignment:
| Q |
84 |
atagatagtcaacataagtcaaaaccctcgaaatcaa |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3521533 |
atagatagtcaacataagtcaaaaccctcgaaatcaa |
3521497 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University