View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2189_low_3 (Length: 333)
Name: NF2189_low_3
Description: NF2189
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2189_low_3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 192; Significance: 1e-104; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 106 - 322
Target Start/End: Complemental strand, 41984362 - 41984146
Alignment:
| Q |
106 |
acaaatatctgtaatgggatctgcatgatcagttcatcatctatagtttttaacaaggccttcactaatgttgatttcactattctgtacttagtaagga |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41984362 |
acaaatatctgtaatgggatctgcatgatcagttcatcatctatagtttttaacaaggccttcactaatgttgatttcactattctgtacttagtaagga |
41984263 |
T |
|
| Q |
206 |
tagcaaattaaaaaacaatttctcccaacatgaccaattatttcttcatgttactggactgnnnnnnncctaattcacaaatgctgtattaatcacccta |
305 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
41984262 |
tagcaaattaaaaaacactttctcccaacatgaccaattatttcttcatgttactggactgtttttttcctaattcacaaatgctgtattaatcacccta |
41984163 |
T |
|
| Q |
306 |
accatatatgtgcctat |
322 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
41984162 |
accatatatgtgcctat |
41984146 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 19 - 65
Target Start/End: Complemental strand, 41984413 - 41984367
Alignment:
| Q |
19 |
catacagcttctacttaatattatcagtctccatttcacctcattgc |
65 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41984413 |
catacagcttctacttaatattatcagtctccatttcacctcattgc |
41984367 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University