View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2189_low_9 (Length: 242)
Name: NF2189_low_9
Description: NF2189
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2189_low_9 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 34216999 - 34217240
Alignment:
| Q |
1 |
tattcaaggttagacgtccccagagagcattttgacattccgccaatcctttcgagtattctacctgaccaattctgatacaaagcgcgtcacccttgaa |
100 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34216999 |
tattcaaggtcagacgtccccagagagcattttgacattccgccaatcctttcgagtattctacctgaccaattctgatacaaagcgcgtcacccttgaa |
34217098 |
T |
 |
| Q |
101 |
acattatgattcatatatgttttagatctatttcatgtatcactgcgagtatgatggaaaaatattttttactcgccggttcctatagataaaattcacc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34217099 |
acattatgattcatatatgttttagatctatttcatgtatcactgcgagtatgatggaaaaatattttttactcgccggttcctatagataaaattcacc |
34217198 |
T |
 |
| Q |
201 |
attgatgagaggaacaaaacagatggggtctcaccttatctc |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34217199 |
attgatgagaggaacaaaacagatggggtctcaccttatctc |
34217240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 48; Significance: 1e-18; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 98 - 173
Target Start/End: Complemental strand, 14621986 - 14621911
Alignment:
| Q |
98 |
gaaacattatgattcatatatgttttagatctatttcatgtatcactgcgagtatgatggaaaaatattttttact |
173 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||||||||| ||||| || |||||||||||||||||| |
|
|
| T |
14621986 |
gaaacattatgattcttatatgttttagatcaatttcatgtatcacaacgagtgggagggaaaaatattttttact |
14621911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 202 - 239
Target Start/End: Complemental strand, 9684748 - 9684711
Alignment:
| Q |
202 |
ttgatgagaggaacaaaacagatggggtctcaccttat |
239 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
9684748 |
ttgatgagaggaacaaaatagatggggtctcaccttat |
9684711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 35 - 99
Target Start/End: Complemental strand, 11482709 - 11482645
Alignment:
| Q |
35 |
acattccgccaatcctttcgagtattctacctgaccaattctgatacaaagcgcgtcacccttga |
99 |
Q |
| |
|
|||||| |||||| |||| | ||||||| |||||||||||||||| || | ||||||| |||||| |
|
|
| T |
11482709 |
acattctgccaatacttttgtgtattcttcctgaccaattctgatgcataacgcgtcaaccttga |
11482645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University