View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2190_high_1 (Length: 442)
Name: NF2190_high_1
Description: NF2190
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2190_high_1 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 247; Significance: 1e-137; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 17 - 263
Target Start/End: Original strand, 7336295 - 7336541
Alignment:
| Q |
17 |
aaacacaaaccaaaacaattgatgatcataattgagaggatgaaaatgaagatgttggtgactcaagataaacctccaaaaagcttttgagacacttcac |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7336295 |
aaacacaaaccaaaacaattgatgatcataattgagaggatgaaaatgaagatgttggtgactcaagataaacctccaaaaagcttttgagacacttcac |
7336394 |
T |
 |
| Q |
117 |
tctatccaactgagctaacaaattagctctaatagttttcaccaacatatcatccaactgagaaactttgatagtgtccaggatattcaactgaccaact |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7336395 |
tctatccaactgagctaacaaattagctctaatagttttcaccaacatatcatccaactgagaaactttgatagtgtccaggatattcaactgaccaact |
7336494 |
T |
 |
| Q |
217 |
acattccccaagacaacatccaactgagcaactatattcatcaacaa |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7336495 |
acattccccaagacaacatccaactgagcaactatattcatcaacaa |
7336541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 62 - 114
Target Start/End: Original strand, 7332258 - 7332310
Alignment:
| Q |
62 |
atgaagatgttggtgactcaagataaacctccaaaaagcttttgagacacttc |
114 |
Q |
| |
|
|||||||||||| ||||| |||||||||| || ||||||||||||||||||| |
|
|
| T |
7332258 |
atgaagatgttgttgacttgagataaaccttcagaaagcttttgagacacttc |
7332310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 62 - 123
Target Start/End: Original strand, 7322905 - 7322966
Alignment:
| Q |
62 |
atgaagatgttggtgactcaagataaacctccaaaaagcttttgagacacttcactctatcc |
123 |
Q |
| |
|
|||||||||||| ||||| | |||||| || || |||| ||||||||||||||| ||||||| |
|
|
| T |
7322905 |
atgaagatgttgctgacttacgataaatcttcagaaagattttgagacacttcaatctatcc |
7322966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University