View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2190_high_8 (Length: 223)
Name: NF2190_high_8
Description: NF2190
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2190_high_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 1 - 211
Target Start/End: Original strand, 4672504 - 4672713
Alignment:
| Q |
1 |
cgaccaagatgtaatggctttcctgaatcgagtatgcatta---cttgagactgtgaaatagctacaagggtttgatcggacattattactctttaatct |
97 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4672504 |
cgaccaagatgtaatgactttcctgaatcgagtatgcattattacttgagactgtgaaatagctacaagggtttgatcggacattattactctttaatct |
4672603 |
T |
|
| Q |
98 |
tgagaatgtgaataactggttggattggaatttatccacagaatccatcagtaacaatatatatgaatcactagtctattttatttggagttgcatattt |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4672604 |
tgagaatgtgaataactggttggattggaagttatccacagaatccatcagtaaca----atatgaatcactagtctattttatttggagttgcatattt |
4672699 |
T |
|
| Q |
198 |
tatttctagcatgc |
211 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
4672700 |
tatttctagcatgc |
4672713 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University