View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2190_low_7 (Length: 239)
Name: NF2190_low_7
Description: NF2190
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2190_low_7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 213; Significance: 1e-117; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 2294247 - 2294467
Alignment:
| Q |
1 |
ttagtctagtttattatgattgaatgtgtagtaccaattcaccacctctcacacacttctcatctttaaaataatccataatcactttccaaccacaaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2294247 |
ttagtctagtttattatgattgaatgagtagtacccattcaccacctctcacacacttctcatctttaaaataatccataatcactttccaaccacaaaa |
2294346 |
T |
|
| Q |
101 |
cataatcgatgaattgaggttgtctttgagattgtgacatctaaataaattgaggtatgtttctttggtcttaatttgatttcattcacaatttgtacat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2294347 |
cataatcgatgaattgaggttgtctttgagattgtgacatctaaataaattgaggtatgtttctttggtcttaatttgatttcattcacaatttgtacat |
2294446 |
T |
|
| Q |
201 |
acatgtttgtcaatgccgtat |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
2294447 |
acatgtttgtcaatgccgtat |
2294467 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 28 - 95
Target Start/End: Original strand, 2316581 - 2316646
Alignment:
| Q |
28 |
gtagtaccaattcaccacctctcacacacttctcatctttaaaataatccataatcactttccaacca |
95 |
Q |
| |
|
|||||||| |||||||||||||||| ||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
2316581 |
gtagtaccggttcaccacctctcaca--cttctcatctttaaaataatctcaaatcactttccaacca |
2316646 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University