View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2192_low_9 (Length: 230)
Name: NF2192_low_9
Description: NF2192
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2192_low_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 41 - 180
Target Start/End: Original strand, 33629808 - 33629947
Alignment:
| Q |
41 |
attattctaagtatgaggggtaccaatcttgaagaactgaatgttttgaacctttcatccaagcattatcatcaccatgaataacaaggaagattttaag |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
33629808 |
attattctaagtatgaggggtaccaatcttgaagaactgaatgttttgaacctttcatccaagcattaccatcaccatgaataacaaggaagattttaag |
33629907 |
T |
|
| Q |
141 |
gtgctcagactttttagattgaatggcaaacccaggaatg |
180 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
33629908 |
gtgttcagactttttagattgaatggcaaacccaggaatg |
33629947 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University