View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2193_high_1 (Length: 218)
Name: NF2193_high_1
Description: NF2193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2193_high_1 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 171; Significance: 5e-92; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 16 - 198
Target Start/End: Original strand, 11849771 - 11849953
Alignment:
| Q |
16 |
agattgcagtgaaaaggatgaaatctgaaatggttggtgacgaagggttgaatgagatcaagtctgaaatcgcggttctcactagggttcgacacaggca |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11849771 |
agattgcagtgaaaaggatgaaatctgaaatggttggtgacgaagggttaaatgagatcaagtctgaaatcgcggttctcactagggttcgacacaggca |
11849870 |
T |
 |
| Q |
116 |
tttggttgcactccatggctattgcttggatgacaatgagaaacttcttgtctttgaatacatgcctcagggaactcttagtc |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11849871 |
tttggttgcactccatggctattgcttggacgacaacgagaaacttcttgtctttgaatacatgcctcagggaactcttagtc |
11849953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 17 - 198
Target Start/End: Complemental strand, 11857357 - 11857176
Alignment:
| Q |
17 |
gattgcagtgaaaaggatgaaatctgaaatggttggtgacgaagggttgaatgagatcaagtctgaaatcgcggttctcactagggttcgacacaggcat |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||| |
|
|
| T |
11857357 |
gattgcagtgaaaaggatgaaatctgaaatggttggtgatgaagggttgaatgagatcaagtccgaaatcgcggttctcactaaggttcgacacaggcat |
11857258 |
T |
 |
| Q |
117 |
ttggttgcactccatggctattgcttggatgacaatgagaaacttcttgtctttgaatacatgcctcagggaactcttagtc |
198 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
11857257 |
ttggttgcactccatggctattgcttggacgacaatgagaaacttcttgtttttgaatacatgcctcagggaactcttagtc |
11857176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 16 - 198
Target Start/End: Original strand, 11836400 - 11836582
Alignment:
| Q |
16 |
agattgcagtgaaaaggatgaaatctgaaatggttggtgacgaagggttgaatgagatcaagtctgaaatcgcggttctcactagggttcgacacaggca |
115 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||| ||||| |||||||||||||||| ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
11836400 |
agattgcagttaaaaggatgaaatctgaaatggttggtgaccaagggctgaatgagatcaagtccgaaatcgcggttctcactaaggttcgacacaggca |
11836499 |
T |
 |
| Q |
116 |
tttggttgcactccatggctattgcttggatgacaatgagaaacttcttgtctttgaatacatgcctcagggaactcttagtc |
198 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || |||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
11836500 |
tttggttgcactccttggctattgcttggacgaaaatgagaaacttcttgtcttcgaatacatgcctcagggaactcttagtc |
11836582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University