View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2193_low_3 (Length: 250)
Name: NF2193_low_3
Description: NF2193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2193_low_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 99; Significance: 6e-49; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 136 - 246
Target Start/End: Original strand, 17525311 - 17525421
Alignment:
| Q |
136 |
aatctcctcctctgtttaatggtagtagcattgatcttcaatagttaaactacatcactttgggacaactcagccaaggcatcgaactaagatcgcaagt |
235 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17525311 |
aatctcctcatctgttcaatggtagtagcattgatcttcaatagttaaactacatcactttaggacaactcagccaaggcatcgaactaagatcgcaagt |
17525410 |
T |
 |
| Q |
236 |
tctcatgtgag |
246 |
Q |
| |
|
||||||||||| |
|
|
| T |
17525411 |
tctcatgtgag |
17525421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 16 - 141
Target Start/End: Original strand, 17525059 - 17525185
Alignment:
| Q |
16 |
atggaattaatgaatgagtaatcatattgaaacatgtcgaatgacaaatacgattttaatttgaagtgtccgtgcaacataacaaatcatcaattttatc |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
17525059 |
atggaattaatgaatgagtaatcatattgaaacatctccaatgacaaatacgattttaatttgaagtgtccgtgcagcctaacaaatcatcaattttatt |
17525158 |
T |
 |
| Q |
116 |
accaatt-aaatatttactgcaatctc |
141 |
Q |
| |
|
||||||| ||||||||| ||||||||| |
|
|
| T |
17525159 |
accaattaaaatatttattgcaatctc |
17525185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University