View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2193_low_7 (Length: 213)
Name: NF2193_low_7
Description: NF2193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2193_low_7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 203
Target Start/End: Original strand, 4243586 - 4243788
Alignment:
| Q |
1 |
ccgttgaattctctaactccgttatcagtctttgtgttcccggtgaaatatcgaatcaacagaacaacaaggactaaaaatgcgacagccaaaccaacct |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4243586 |
ccgttgaactctctaactccgttatcagtctttgtgttcccggtgaaatatcgaatcaacagaacaacaaggactaaaaatgcgacagccaaaccaacct |
4243685 |
T |
|
| Q |
101 |
ttccgattgaggatgtaagtttattcaaccttgtttgcaaaggggtttcttcgttgatgtcattgcttatggaactcatcatttgtccccatgttgtgtt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4243686 |
ttccgattgaggatgtaagtttattcaaccttgtttgcaaaggggtttcttcgttgatgtcattgcttatggaactcatcatttgtccccatgttgtgtt |
4243785 |
T |
|
| Q |
201 |
cat |
203 |
Q |
| |
|
||| |
|
|
| T |
4243786 |
cat |
4243788 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 128; Significance: 2e-66; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 4 - 203
Target Start/End: Original strand, 6186645 - 6186844
Alignment:
| Q |
4 |
ttgaattctctaactccgttatcagtctttgtgttcccggtgaaatatcgaatcaacagaacaacaaggactaaaaatgcgacagccaaaccaacctttc |
103 |
Q |
| |
|
|||||||||||||||||| |||||||||||| ||||||||||||||||||| ||| |||||||| ||||||||||| |||||| |||||||||| |||| |
|
|
| T |
6186645 |
ttgaattctctaactccggcatcagtctttgtattcccggtgaaatatcgaaccaagagaacaaccaggactaaaaacgcgacaaccaaaccaacttttc |
6186744 |
T |
|
| Q |
104 |
cgattgaggatgtaagtttattcaaccttgtttgcaaaggggtttcttcgttgatgtcattgcttatggaactcatcatttgtccccatgttgtgttcat |
203 |
Q |
| |
|
|||| || ||||| || ||||||||||||||||||||||| ||||| || | ||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
6186745 |
cgatcgatgatgttagcttattcaaccttgtttgcaaaggtgtttcctcatcgatgtcattgcttatcgaactcatcatttgtccccatgttgtgttcat |
6186844 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University