View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2194_high_23 (Length: 231)
Name: NF2194_high_23
Description: NF2194
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2194_high_23 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 99; Significance: 5e-49; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 102 - 217
Target Start/End: Complemental strand, 32870259 - 32870148
Alignment:
| Q |
102 |
cgtttgtttatttctcatattgaactagtcagtcaatttaaaataacatgggataaagatttgcgactaataaatataaaagaaacacgagacaaaaatt |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32870259 |
cgtttgtttatttctcatattgaactagtca----atttaaaataacatgggataaagatttgcgactaataaatataaaagaaacacgagacaaaaatt |
32870164 |
T |
 |
| Q |
202 |
tatgaccgataaatat |
217 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
32870163 |
tatgaccgataaatat |
32870148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 1 - 97
Target Start/End: Complemental strand, 32871284 - 32871189
Alignment:
| Q |
1 |
cgatctatttagatggcnnnnnnnccatgtagatataggtttctgtttggggaattcgtcgtcgcagaataaacgttgttttatctgtcgttttggt |
97 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||| ||||| |||||| |||||| ||| |||||||||||||||||||||| |
|
|
| T |
32871284 |
cgatctatttagatggctttttttccatgtagatataggtttctgtttggtgaatttgtcgtcccagaat-aaccttgttttatctgtcgttttggt |
32871189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University