View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2194_high_9 (Length: 367)
Name: NF2194_high_9
Description: NF2194
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2194_high_9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 176; Significance: 1e-94; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 176; E-Value: 1e-94
Query Start/End: Original strand, 18 - 244
Target Start/End: Original strand, 12882092 - 12882319
Alignment:
| Q |
18 |
gaaggtggagaaacatgttggtggaccaagaacaagtacttttggaagctctttggccattgaattttaaggatttgtggtgtttgagaaagggatgaaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12882092 |
gaaggtggagaaacatgttggtggaccaagaacaagtacttttggaaggtctttggccattgaattttaaggatttgtggtgtttgagaaagggatgaac |
12882191 |
T |
|
| Q |
118 |
ttagcactctcatttggatgacactcaaaactgtggctagaaactcctcttaatta-ttctctgtatcacttgtcttccatgaagcaccaacacgtctta |
216 |
Q |
| |
|
|||||||| | ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||| | |||| | |||| |
|
|
| T |
12882192 |
ttagcacttttatttggatgacactcaaaactgtggctagaaactcctcttaattatttctctgtatcacttgacttccatgaagcgcgaacatgcctta |
12882291 |
T |
|
| Q |
217 |
gattagaagtattccggtgtcggataca |
244 |
Q |
| |
|
||||||| ||||| |||||||||||||| |
|
|
| T |
12882292 |
gattagacgtatttcggtgtcggataca |
12882319 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 310 - 356
Target Start/End: Original strand, 12882380 - 12882426
Alignment:
| Q |
310 |
gctgtgtcaatatccgtgtcgtgtctgtgttcgtattcgtgcttcat |
356 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12882380 |
gctgtgtcgatatccgtgtcgtgtctgtgttcgtattcgtgcttcat |
12882426 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 313 - 356
Target Start/End: Complemental strand, 8101079 - 8101036
Alignment:
| Q |
313 |
gtgtcaatatccgtgtcgtgtctgtgttcgtattcgtgcttcat |
356 |
Q |
| |
|
|||||||||||||||| |||||||||| ||||||| |||||||| |
|
|
| T |
8101079 |
gtgtcaatatccgtgttgtgtctgtgtccgtattcatgcttcat |
8101036 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University