View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2194_low_11 (Length: 343)
Name: NF2194_low_11
Description: NF2194
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2194_low_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 215; Significance: 1e-118; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 13 - 240
Target Start/End: Complemental strand, 40952841 - 40952610
Alignment:
| Q |
13 |
aatattgcgcagttaagaagaataaataaaaaaccatggtgcagttgttag----agaaacagattaatggataatatttcataaactattcttggtata |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40952841 |
aatattgcgcagttaagaagaataaataaaaaaccatggtgcagttgttagctagagaaacagattaatggataatatttcataaactattcttggtata |
40952742 |
T |
 |
| Q |
109 |
tgaaagtcttcacctaatttgattctgatgtagaagataattgtcaaaatttgaagaaaatcttgcttctatggaaaaatggacatccctcgtccttact |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40952741 |
tgaaagtcttcacctaatttgattctgatgtagaagataattgtcaaaatttgaagaaaatcttgcttctatggaaaaatggacatccctcgtccttact |
40952642 |
T |
 |
| Q |
209 |
ctggtggagaaggttgatacaaatatggatgc |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
40952641 |
ctggtggagaaggttgatacaaatatggatgc |
40952610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 278 - 327
Target Start/End: Complemental strand, 40952608 - 40952559
Alignment:
| Q |
278 |
aaccgaacttcaagggcaaacccaaactaggacagtttggtatttaaaat |
327 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
40952608 |
aaccgaacttcaagggcaaacccaacctaggacagtttggtatttaaaat |
40952559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University