View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2194_low_17 (Length: 273)
Name: NF2194_low_17
Description: NF2194
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2194_low_17 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 164; Significance: 1e-87; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 18 - 263
Target Start/End: Complemental strand, 33216622 - 33216375
Alignment:
| Q |
18 |
attcagaaccaggtaaaccaagtcttaactcagtagccttgaggttcaagccattgttacttctttgagaaaatatctcagaactttccattgtagtagt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33216622 |
attcagaaccaggtaaaccaagtcttaactcagtagccttgaggttcaagccattgttacttctttgagaaaatatctcagaactttccattgtagtagt |
33216523 |
T |
 |
| Q |
118 |
ggaaactttaacttcagtttgcaaaacaactttagtataaagaaaaataatgat--nnnnnnnnnnnnnnnnnnnttgaatagtggaaaaacaaagaagt |
215 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||| |||||| ||||||||||||||||||||||||| |
|
|
| T |
33216522 |
ggaaactttaacttcagtttgcaaaactactttagtataaagaaaaacaatgatgagagagagagagagagagagttgaatagtggaaaaacaaagaagt |
33216423 |
T |
 |
| Q |
216 |
ttgaagttttgttttgatgaatagagaaggttctgtctgaggtctgtg |
263 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
33216422 |
ttgaagttttgtattgatgaatagagaaggttctgtctgaggtttgtg |
33216375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University