View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2194_low_18 (Length: 259)
Name: NF2194_low_18
Description: NF2194
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2194_low_18 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 244
Target Start/End: Complemental strand, 45669097 - 45668854
Alignment:
| Q |
1 |
ctccaacagctaaagcaattacctatatttagtcaatgtatgtacatattattagtttaattgtagagtattgtaagaaattctagtttaattattgtgt |
100 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45669097 |
ctccaacagctaaagcaattacctacatttagtcaatgtatgtacatattattagtttaattgtagagtattgtaagaaattctagtttaattattgtgt |
45668998 |
T |
 |
| Q |
101 |
acattttgttttatttaacttttagttaaaacaacataagtgaaactgcaatgttcaccttgttcctaataaccggcgaattgtctgaaaaccatgtatc |
200 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45668997 |
acattttgttttatttaactattacttaaaacaacgtaagtgaaactgcaatgttcaccttgttcctaataaccggcgaattgtctgaaaaccatgtatc |
45668898 |
T |
 |
| Q |
201 |
ttgcctctcagtttggcagtgagcgaaacacgaattgataaaca |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
45668897 |
ttgcctctcagtttggcagtgagcgaaacatgaattgataaaca |
45668854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University