View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2194_low_22 (Length: 243)
Name: NF2194_low_22
Description: NF2194
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2194_low_22 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 23 - 231
Target Start/End: Original strand, 40051809 - 40052017
Alignment:
| Q |
23 |
aacaccaacagacttaagagtctcagcacgaggttgataagcaaaagcatctctgtgaatcggactagaaacttggttatgatcaggataactacgttcc |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40051809 |
aacaccaacagacttaagagtctcagcacgaggttgataagcaaaagcatctctgtgaatcggactagaaacttggttatgatcaggataactacgttcc |
40051908 |
T |
 |
| Q |
123 |
tgaacatgtgcaattttcctaaagaatgaactcttaaagaatctatcagattcctccataacatgatcgggttccactacttcaggaacagtctctctcc |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40051909 |
tgaacatgtgcaattttcctaaagaatgaactcttaaagaatctatcagattcctccataacatgatcgggttccactacttcaggaacagtctctctcc |
40052008 |
T |
 |
| Q |
223 |
tttgcttct |
231 |
Q |
| |
|
|||| |||| |
|
|
| T |
40052009 |
tttgtttct |
40052017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University