View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2195_low_10 (Length: 236)
Name: NF2195_low_10
Description: NF2195
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2195_low_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 153; Significance: 3e-81; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 5 - 157
Target Start/End: Complemental strand, 48170469 - 48170317
Alignment:
| Q |
5 |
ttgctgtttcttcttcatttatgaggctaatttcacgaatcataaatataattatgggcttgatcttcgttttttggtagatgttgttctgttttgcgtg |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48170469 |
ttgctgtttcttcttcatttatgaggctaatttcacgaatcataaatataattatgggcttgatcttcgttttttggtagatgttgttctgttttgcgtg |
48170370 |
T |
 |
| Q |
105 |
cagaaagttgccttgcctttctattctactgtcattctctctagtttatatta |
157 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48170369 |
cagaaagttgccttgcctttctattctactgtcattctctctagtttatatta |
48170317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 149 - 221
Target Start/End: Complemental strand, 48168849 - 48168776
Alignment:
| Q |
149 |
tttatattattataagaaaatacaagagtttcttacgaacatgc-tatccatgtaccaggagatgggtagagat |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
48168849 |
tttatattattataagaaaatacaagagtttcttacgaacatgcatatccatgtaccaggagatgggtagagat |
48168776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University