View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2195_low_5 (Length: 306)
Name: NF2195_low_5
Description: NF2195
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2195_low_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 19 - 284
Target Start/End: Complemental strand, 41359801 - 41359537
Alignment:
| Q |
19 |
aaatatacacaaaaattcaaatgtatttgttcgaaannnnnnnnnnnnatttatatttcagatcaaagagaatacatctgattgaaaatgattctctaga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
41359801 |
aaatatacacaaaaattcaaatgtatttgttcgaaatttgacttttt-atttatatttcagatcaaagagaatacatctcatggaaaatgattctctaga |
41359703 |
T |
 |
| Q |
119 |
ctaacttgtgttggtcagaaagttcgagaagtttaaccaaaaagtataccaccatcagaaatcaaacacgggtatgagccgagcctgtccctcaaaatgg |
218 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41359702 |
ctaacttgtgttggtcggaaagttcgagaagtttaaccaaaaagtataccaccatcagaaatcaaacacgggtatgagccgagcctgtccctcaaaatgg |
41359603 |
T |
 |
| Q |
219 |
aaggcctagcacctagccttatgattgttgagcgcatggtttaaaattgtggtcgctgttacattg |
284 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
41359602 |
aaggcctagcacctagccttatgattgttgagcgcatggtttaaaattgtggtcgctgttatattg |
41359537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University