View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2195_low_9 (Length: 237)
Name: NF2195_low_9
Description: NF2195
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2195_low_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 67; Significance: 7e-30; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 1 - 137
Target Start/End: Complemental strand, 35827249 - 35827122
Alignment:
| Q |
1 |
catgtcttttatttgacacaagttcataatttctctgtgcccccctcccc-----aaagaaaatgcaaacgtttatataaaatcaaattatataaaaacc |
95 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
35827249 |
catgtcttttatttgacacaagttcataatttctctgtgcccccctcccctccccaaagaaaatgcaa--------------tcaaattatataaaaacc |
35827164 |
T |
 |
| Q |
96 |
cagcagcaggtcaccacatgcaccttgtcttcctctcattag |
137 |
Q |
| |
|
|||||||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
35827163 |
cagcagcaggtcaccacatgcaccatgttttcctctcattag |
35827122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University