View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2196_high_3 (Length: 250)
Name: NF2196_high_3
Description: NF2196
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2196_high_3 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 213; Significance: 1e-117; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 18 - 250
Target Start/End: Original strand, 4162526 - 4162758
Alignment:
| Q |
18 |
ggaatatataatttgtcaattgattcaaacaaaaaggtcattcaggtactgggttggcatagataatcatactttttgtttgcattagttgtgtcttagg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4162526 |
ggaatatataatttgtcaattgattcaaacaaaaaggtcatttaggtactgggttggcatagataatcatactttttgtttgcattagttgtgtcttagg |
4162625 |
T |
|
| Q |
118 |
ttcgaatgcatgcgaacataagtttcgattatgtatgccagctctttaccttatgtatctcctttttgtttgaatatgttcgcaaatcgtgcatttgaat |
217 |
Q |
| |
|
||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
4162626 |
ttcgaatacatgggaacataagtttcgattatgtatgccagctctttaccttatgtatctcctttttgtttgaatatgttcgtaaatcgtgcatttgaat |
4162725 |
T |
|
| Q |
218 |
tagacttttggttaaattacacttcgacccttt |
250 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |
|
|
| T |
4162726 |
tagactttaggttaaattacacttcgacccttt |
4162758 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 38 - 96
Target Start/End: Original strand, 4162440 - 4162498
Alignment:
| Q |
38 |
tgattcaaacaaaaaggtcattcaggtactgggttggcatagataatcatactttttgt |
96 |
Q |
| |
|
|||||||||||||||||||||| |||||||| ||||| ||||||||||| ||||||||| |
|
|
| T |
4162440 |
tgattcaaacaaaaaggtcatttaggtactgagttggtatagataatcaaactttttgt |
4162498 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University