View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2197_high_16 (Length: 240)
Name: NF2197_high_16
Description: NF2197
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2197_high_16 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 12 - 221
Target Start/End: Original strand, 10680018 - 10680227
Alignment:
| Q |
12 |
gagatgaatcataggaaaaagtttgctgttggatggaatagaatttttgtcaattgnnnnnnnngtagaggcctaatgagtatggtgaggaatcatacta |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
10680018 |
gagatgaatcataggaaaaagtttgctgttggatggaatagaatttttgtcaattgaaaaaaaagtagaggcctaatgagtatggtgaggaatcatacta |
10680117 |
T |
 |
| Q |
112 |
tatataaattgcttaatactaaacatgattactaaacatgtacatgatgcaagacacgacattcattattcaatgcaagactcaagctacagctgctctg |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
10680118 |
tatataaattgcttaatactaaacatgattactaaacatgtacatgatgcaagacacgacattcattattcaatgcaagactcgagctacagctactctg |
10680217 |
T |
 |
| Q |
212 |
tcgatgcacg |
221 |
Q |
| |
|
|||||||||| |
|
|
| T |
10680218 |
tcgatgcacg |
10680227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University