View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2197_high_7 (Length: 359)
Name: NF2197_high_7
Description: NF2197
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2197_high_7 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 161; Significance: 8e-86; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 161; E-Value: 8e-86
Query Start/End: Original strand, 18 - 236
Target Start/End: Complemental strand, 3141668 - 3141447
Alignment:
| Q |
18 |
aacatgcggggcttaaatttagagggacaccttggttgtctacaatata----ctaattacttaaacaannnnnnnnggatgatcaaatatcaccactct |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
3141668 |
aacatgcggggcttaaatttagagggacaccttggttgtctacaatatatatactaattatttaaacaattttttt-ggatgatcaaatatcaccactct |
3141570 |
T |
 |
| Q |
114 |
taaacaaactacaatgacgagccagagattcttattactaatatttattttctaatctgaaatattgtatatactcatgtaagataattaaccacctgtc |
213 |
Q |
| |
|
|||||||| ||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3141569 |
taaacaaaatacaatgacgagctagagattcttattactaagatttattttctaatctgaaatattgtatatactcatgtaagataattaaccacctgtc |
3141470 |
T |
 |
| Q |
214 |
tagttttacggtcaaagtttgaa |
236 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
3141469 |
tagttttacggtcaaagtttgaa |
3141447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 96; E-Value: 5e-47
Query Start/End: Original strand, 257 - 352
Target Start/End: Complemental strand, 3141011 - 3140916
Alignment:
| Q |
257 |
gtgtgaaactattttttgtgagtgaacaagtgtcaaacttaatacaatcaaattaaatgataaacataacttcatatcaaagtggcattcatctct |
352 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3141011 |
gtgtgaaactattttttgtgagtgaacaagtgtcaaacttaatacaatcaaattaaatgataaacataacttcatatcaaagtggcattcatctct |
3140916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University