View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2197_low_18 (Length: 245)
Name: NF2197_low_18
Description: NF2197
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2197_low_18 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 159; Significance: 9e-85; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 1 - 159
Target Start/End: Complemental strand, 44166357 - 44166199
Alignment:
| Q |
1 |
tgtggttggttgggccagagagcaagaataggcaaagattacgtggcggctaagatcctttgctgacttttttgttgcaaaagtagatagaaacagaaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44166357 |
tgtggttggttgggccagagagcaagaataggcaaagattacgtggcggctaagatcctttgctgacttttttgttgcaaaagtagatagaaacagaaaa |
44166258 |
T |
|
| Q |
101 |
gagagacacaaacatggctactttgaatgttttctctcaaccattgcaccctacaacta |
159 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44166257 |
gagagacacaaacatggctactttgaatgttttctctcaaccattgcaccctacaacta |
44166199 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University