View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2198_high_13 (Length: 280)
Name: NF2198_high_13
Description: NF2198
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2198_high_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 94; Significance: 6e-46; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 94; E-Value: 6e-46
Query Start/End: Original strand, 129 - 246
Target Start/End: Original strand, 31784630 - 31784747
Alignment:
| Q |
129 |
ccatcactctatttctaccattctacggtcgtcgcagacctctctcttatgcaagtacacaagttttatacacattttttaccccttaacttttaaaaaa |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||| ||||||||||||||||| |||||||||| |
|
|
| T |
31784630 |
ccatcactctatttctaccattctacggtcgtcgcagacctctgtcttatgcaggtacacaagttttatatccattttttaccccttaatttttaaaaaa |
31784729 |
T |
 |
| Q |
229 |
ttacgattttgttcctaa |
246 |
Q |
| |
|
|||||||||||| ||||| |
|
|
| T |
31784730 |
ttacgattttgtccctaa |
31784747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 17 - 59
Target Start/End: Original strand, 31784518 - 31784560
Alignment:
| Q |
17 |
acatggcactttgcataattagttcaccattcgatttccacat |
59 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31784518 |
acatggcactttgcataattagttcaccattcgatttccacat |
31784560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 202 - 239
Target Start/End: Original strand, 36658533 - 36658570
Alignment:
| Q |
202 |
attttttaccccttaacttttaaaaaattacgattttg |
239 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
36658533 |
atttttgaccccttaacttttaaaaaattacgattttg |
36658570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University