View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2198_high_6 (Length: 419)

Name: NF2198_high_6
Description: NF2198
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2198_high_6
NF2198_high_6
[»] chr2 (1 HSPs)
chr2 (179-403)||(31658583-31658807)


Alignment Details
Target: chr2 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 179 - 403
Target Start/End: Original strand, 31658583 - 31658807
Alignment:
179 ccaatgccaaactttgaaaataaatttacacttagacagaaacatatccatagccatcaaaatcctaactggtcataaacattctcaaattcaaatgatt 278  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31658583 ccaatgccaaactttgaaaataaatttacacttagacagaaacatatccatagccatcaaaatcctaactggtcataaacattctcaaattcaaatgatt 31658682  T
279 caatcgatgatagcatagtggcatgtctcaaataatcaaaacaaaattcaaagttacatgatatgaggttatctgatgagaacaattgattttgagaaga 378  Q
    ||||||||||||||||||||||| ||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31658683 caatcgatgatagcatagtggcacgtctcaaataatcaaaataaacttcaaagttacatgatatgaggttatctgatgagaacaattgattttgagaaga 31658782  T
379 ataatcatcatgaatctcttcctta 403  Q
    |||||||||||||||||||||||||    
31658783 ataatcatcatgaatctcttcctta 31658807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University