View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2198_low_19 (Length: 269)
Name: NF2198_low_19
Description: NF2198
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2198_low_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 10 - 251
Target Start/End: Complemental strand, 2361348 - 2361107
Alignment:
| Q |
10 |
gcagagaccatggggaaaatgggcggcggagataagagacccggcgcgtggagtgcgtgtgtggcttggtacatttcaaacggctgaagaagctgctatt |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2361348 |
gcagagaccatggggaaaatgggcggcggagataagagacccggcgcgtggagtgcgtgtgtggcttggtacatttcaaacggctgaagaagctgctatt |
2361249 |
T |
 |
| Q |
110 |
gtgtacgacaacgcggctattaagttgcgtggaccagacgcgctaactaatttcataactccacctgtaagtgcagctgccacgtgtcagttatcatcac |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2361248 |
gtgtacgacaacgcggctattaagttgcgtggaccagacgcgctaactaatttcataactccacctgtaagtgcagctgccacgtgtcagttatcatcac |
2361149 |
T |
 |
| Q |
210 |
caccaccggaaaatgaaattcctcttccgtcattaccgttac |
251 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
2361148 |
caccaccggaaaatgaaattcctctttcgtcattaccgttac |
2361107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 11 - 51
Target Start/End: Original strand, 41747958 - 41747998
Alignment:
| Q |
11 |
cagagaccatggggaaaatgggcggcggagataagagaccc |
51 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
41747958 |
cagagaccttggggaaaatgggcggcggagataagagaccc |
41747998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000009; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 77 - 150
Target Start/End: Original strand, 41197538 - 41197611
Alignment:
| Q |
77 |
ggtacatttcaaacggctgaagaagctgctattgtgtacgacaacgcggctattaagttgcgtggaccagacgc |
150 |
Q |
| |
|
||||| ||| |||| || |||||||||||||| || || ||||| || ||||||||| | |||||||||||||| |
|
|
| T |
41197538 |
ggtacttttgaaactgcagaagaagctgctatggtttatgacaatgccgctattaagcttcgtggaccagacgc |
41197611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 11 - 48
Target Start/End: Complemental strand, 43490190 - 43490153
Alignment:
| Q |
11 |
cagagaccatggggaaaatgggcggcggagataagaga |
48 |
Q |
| |
|
||||||||||||||||||||||| || ||||||||||| |
|
|
| T |
43490190 |
cagagaccatggggaaaatgggcagcagagataagaga |
43490153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University