View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2198_low_22 (Length: 264)
Name: NF2198_low_22
Description: NF2198
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2198_low_22 |
 | |
|
| [»] scaffold0236 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold0236 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: scaffold0236
Description:
Target: scaffold0236; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 21 - 264
Target Start/End: Complemental strand, 21148 - 20905
Alignment:
| Q |
21 |
accgttaccccagccctaatcatagtcacaataccgggcgcttgggtaaatggtgacaagattgttctgccaagaaaaatatcatcttttcctaaccacc |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
21148 |
accgttaccccagccctaatcatagtcacactaccgggcgcttgggtaaatggtgacaagattgttctgccaagaaaaatatcatcttttcctgaccacc |
21049 |
T |
|
| Q |
121 |
aaacgatgacttcaacgtttttgtaagaaacgatttgttcatcgtagttgggagcatggaaaaataatgttaaattcaatgtggccgttaaatcaacggc |
220 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21048 |
aaacgatgacttcaacgtttttgtaacaaacgattttttcatcgtagttgggagcatggaaaaataatgttaaattcaatgtggccgttaaatcaacggc |
20949 |
T |
|
| Q |
221 |
ttgagtattgagggatgttacggtgatagggttgagatgaacaa |
264 |
Q |
| |
|
||||||||||||||||||||||||||||| || ||||||||||| |
|
|
| T |
20948 |
ttgagtattgagggatgttacggtgatagagtcgagatgaacaa |
20905 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University