View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2198_low_6 (Length: 419)
Name: NF2198_low_6
Description: NF2198
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2198_low_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 179 - 403
Target Start/End: Original strand, 31658583 - 31658807
Alignment:
| Q |
179 |
ccaatgccaaactttgaaaataaatttacacttagacagaaacatatccatagccatcaaaatcctaactggtcataaacattctcaaattcaaatgatt |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31658583 |
ccaatgccaaactttgaaaataaatttacacttagacagaaacatatccatagccatcaaaatcctaactggtcataaacattctcaaattcaaatgatt |
31658682 |
T |
 |
| Q |
279 |
caatcgatgatagcatagtggcatgtctcaaataatcaaaacaaaattcaaagttacatgatatgaggttatctgatgagaacaattgattttgagaaga |
378 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31658683 |
caatcgatgatagcatagtggcacgtctcaaataatcaaaataaacttcaaagttacatgatatgaggttatctgatgagaacaattgattttgagaaga |
31658782 |
T |
 |
| Q |
379 |
ataatcatcatgaatctcttcctta |
403 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
31658783 |
ataatcatcatgaatctcttcctta |
31658807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University