View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2199_low_11 (Length: 274)
Name: NF2199_low_11
Description: NF2199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2199_low_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 1 - 150
Target Start/End: Complemental strand, 4163338 - 4163189
Alignment:
| Q |
1 |
attaatggtattactatagtgattggtaattttggagaacccannnnnnnncttcaatgctgcaaaagtatagagataaaaatgtgatatgtgaataatt |
100 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4163338 |
attaatggtattactatagtgatcggtaattttggagaacccattttttttcttcaatgctgcaaaagtatagagataaaaatgtgatatgtgaataatt |
4163239 |
T |
|
| Q |
101 |
ttttggaattcagtcttttatatgcaagtaaggggaacatgttgtgcata |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4163238 |
ttttggaattcagtcttttatatgcaagtaaggggaacatgttgtgcata |
4163189 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 171 - 238
Target Start/End: Complemental strand, 4163199 - 4163132
Alignment:
| Q |
171 |
tgttgtgcataccctatagcttttttattaattataaatcgtaaattacaatttcggtccctaaatta |
238 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
4163199 |
tgttgtgcatatcctatagcttttttattaattataaatcgtaaattacaattttggtccctaaatta |
4163132 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University