View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2199_low_15 (Length: 223)
Name: NF2199_low_15
Description: NF2199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2199_low_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 117; Significance: 9e-60; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 16 - 132
Target Start/End: Original strand, 45742638 - 45742754
Alignment:
| Q |
16 |
atgaaagaaacaaacacaatatcgtttcacactacttattaacacttggcataaaatggttataaattttttgttaacttctggaggaaaaaggtgataa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45742638 |
atgaaagaaacaaacacaatatcgtttcacactacttattaacacttggcataaaatggttataaattttttgttaacttctggaggaaaaaggtgataa |
45742737 |
T |
 |
| Q |
116 |
cgacaccttttgaaact |
132 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
45742738 |
cgacaccttttgaaact |
45742754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University