View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2200_high_13 (Length: 235)
Name: NF2200_high_13
Description: NF2200
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2200_high_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 106; Significance: 4e-53; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 106 - 223
Target Start/End: Complemental strand, 36744374 - 36744257
Alignment:
| Q |
106 |
atattatcatgcaatcatatcatatatctaattatggtacatatacacagtaatggaggaagagaatgcactaggagatccgccaattactcgcaatttg |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
36744374 |
atattatcatgcaatcatatcatatatctaattatggcacatatagacagtaatggaggaagagaatgcactgggagatccgccaattactcgcaatttg |
36744275 |
T |
|
| Q |
206 |
atatgaaggtagtttttg |
223 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
36744274 |
atatgaaggtagtttttg |
36744257 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 1 - 108
Target Start/End: Complemental strand, 36744515 - 36744408
Alignment:
| Q |
1 |
gcagcatgtaacacttacaaataataattgcccgcccattatctctcacatgtatggtcagccaaaatttaattggtcaaatatcttatttttatgcatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
36744515 |
gcagcatgtaacacttacaaataataattgcccgcccattatctctctcatgtatggtcagccaaaatttaatcggtcaaatatcctatttttatgcatt |
36744416 |
T |
|
| Q |
101 |
cttctata |
108 |
Q |
| |
|
|||||||| |
|
|
| T |
36744415 |
cttctata |
36744408 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 49 - 105
Target Start/End: Complemental strand, 3586812 - 3586756
Alignment:
| Q |
49 |
catgtatggtcagccaaaatttaattggtcaaatatcttatttttatgcattcttct |
105 |
Q |
| |
|
|||||||| ||||||| || |||||||||||| ||| |||||||||||||||||| |
|
|
| T |
3586812 |
catgtatgatcagccataacctaattggtcaaacatcacatttttatgcattcttct |
3586756 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 49 - 105
Target Start/End: Complemental strand, 30805254 - 30805198
Alignment:
| Q |
49 |
catgtatggtcagccaaaatttaattggtcaaatatcttatttttatgcattcttct |
105 |
Q |
| |
|
|||||||||||||||| || ||||||||||||| || ||||||| || |||||||| |
|
|
| T |
30805254 |
catgtatggtcagccagaacctaattggtcaaatctcctatttttgtggattcttct |
30805198 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University