View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2200_low_13 (Length: 239)
Name: NF2200_low_13
Description: NF2200
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2200_low_13 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 96; Significance: 3e-47; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 136 - 239
Target Start/End: Complemental strand, 16594483 - 16594380
Alignment:
| Q |
136 |
ttcatacatttataaatattaattaagttagttaaataaattgaattttttaagttataattgtagttgcccttagtatacttttgtattgatgatgttt |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
16594483 |
ttcatacatttataaatattaattaagttagttaaataaattgaattttttaagttataattgtagttgcccttagtatgcttttgttttgatgatgttt |
16594384 |
T |
|
| Q |
236 |
gatt |
239 |
Q |
| |
|
|||| |
|
|
| T |
16594383 |
gatt |
16594380 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 24 - 60
Target Start/End: Complemental strand, 16594595 - 16594559
Alignment:
| Q |
24 |
tgtttgggtttcaatacattatgttatgtgtctgaac |
60 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16594595 |
tgtttgggtttcaatacattatgttatgtgtctgaac |
16594559 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University