View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2200_low_15 (Length: 209)
Name: NF2200_low_15
Description: NF2200
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2200_low_15 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 17 - 194
Target Start/End: Complemental strand, 44753894 - 44753717
Alignment:
| Q |
17 |
gtgtcgtgtcgtcatctcacgcgattttccacatgtgtcttcgatcagctaaatttatgcgtcttcccgaggaattgttgtctcattttttccctttttg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
44753894 |
gtgtcgtgtcgtcatctcacgcgattttccacatgtgtcttcgatcagctaaatttatgcgtcttcccgaggaattgttgtctcgttttttcccttttta |
44753795 |
T |
 |
| Q |
117 |
aagaggcgtaaaacctattccacttcatttcacatttcgtcgcttccgatccatccccttgcttactttccgcctttg |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
44753794 |
aagaggcgtaaaacctattccacttcatttcacatttcgtcgcttccgatccatcctcttgcttactttccgcctttg |
44753717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 55; Significance: 8e-23; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 55; E-Value: 8e-23
Query Start/End: Original strand, 17 - 164
Target Start/End: Complemental strand, 20502915 - 20502768
Alignment:
| Q |
17 |
gtgtcgtgtcgtcatctcacgcgattttccacatgtgtcttcgatcagctaaatttatgcgtcttcccgaggaattgttgtctcattttttc-ccttttt |
115 |
Q |
| |
|
|||||||||||||||||| | || | || |||| |||||||||||| |||||| || ||||||||| |||||||| |||| |||||||| ||||||| |
|
|
| T |
20502915 |
gtgtcgtgtcgtcatctcgcacggtctttcacacgtgtcttcgatccactaaatctacgcgtcttcctaaggaattgaagtcttattttttctccttttt |
20502816 |
T |
 |
| Q |
116 |
gaagaggcgtaaaacctattcca-cttcatttcacatttcgtcgcttccg |
164 |
Q |
| |
|
|||||||||||||||||||| | |||||||| |||||||||||||||| |
|
|
| T |
20502815 |
aaagaggcgtaaaacctattctaccttcattt--catttcgtcgcttccg |
20502768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University