View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2201_high_13 (Length: 265)
Name: NF2201_high_13
Description: NF2201
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2201_high_13 |
 |  |
|
| [»] scaffold0449 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0449 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: scaffold0449
Description:
Target: scaffold0449; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 11 - 247
Target Start/End: Complemental strand, 4071 - 3835
Alignment:
| Q |
11 |
cagagatagtgaaagagtttacgatatttgctgcgtcgtcatttgtatgttacattctctcaatcatcctcaagaaaaccctaatgctctgcccaacctg |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4071 |
cagagatagtgaaagagtttacgatatttgctgcgtcgtcatttgtatgttacattctctcaatcatcctcaagaaaaccctaatgctctgcccaacctg |
3972 |
T |
 |
| Q |
111 |
aaccagctgccgcgcgataactttgatatgtgattttctatttttctttggatggtgcttttacgcgctgctcatgctccaatatgtcattcctctcaaa |
210 |
Q |
| |
|
|||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3971 |
gaccagccgccgcgccataactttgatatgtgattttctatttttctttggatggtgcttttacgcgctgctcatgctccaatatgtcattcctctcaaa |
3872 |
T |
 |
| Q |
211 |
gatcttggcctctccactttcactataactatactct |
247 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
3871 |
gatcttggcctctccactttcactacaactatactct |
3835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University