View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2201_high_19 (Length: 219)
Name: NF2201_high_19
Description: NF2201
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2201_high_19 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 16 - 184
Target Start/End: Original strand, 41942649 - 41942817
Alignment:
| Q |
16 |
gaaggttgagagaaataaataaattgaaataacataaggtcagagcttgtttgaaatgtcatttcaaagtacaacacattattattcagagtatatgaat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41942649 |
gaaggttgagagaaataaataaattgaaataacataaggtcagagcttgtttgaaatgtcatttcaaagtacaacacattattattcagagtatatgaat |
41942748 |
T |
 |
| Q |
116 |
atgaattgtgtctatttttccctgatcagcccaaccaacaaaaacgggactccacgttctctgtctcca |
184 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41942749 |
atgaattgtgtctatttttccctgatcagcccaaccaacaaaaacgggactccacgttctctgtctcca |
41942817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University