View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2201_high_20 (Length: 204)

Name: NF2201_high_20
Description: NF2201
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2201_high_20
NF2201_high_20
[»] chr4 (1 HSPs)
chr4 (18-158)||(19387911-19388051)


Alignment Details
Target: chr4 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 18 - 158
Target Start/End: Complemental strand, 19388051 - 19387911
Alignment:
18 agaatacggtggtattgatgtaaattcgaccacaatttcagttatggacgttgcttgttgtgattacttgcattgcatgccatatatggttattattact 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
19388051 agaatacggtggtattgatgtaaattcgaccacaatttcagttatggacgttgcttgttgtgattacttgcattgcatgccatatatggttattattact 19387952  T
118 tgctactttatctttcaaacccatattattatggctcgtga 158  Q
    |||||||||||||||||||||||||||||||||||||||||    
19387951 tgctactttatctttcaaacccatattattatggctcgtga 19387911  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University