View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2201_low_24 (Length: 219)

Name: NF2201_low_24
Description: NF2201
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2201_low_24
NF2201_low_24
[»] chr2 (1 HSPs)
chr2 (16-184)||(41942649-41942817)


Alignment Details
Target: chr2 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 16 - 184
Target Start/End: Original strand, 41942649 - 41942817
Alignment:
16 gaaggttgagagaaataaataaattgaaataacataaggtcagagcttgtttgaaatgtcatttcaaagtacaacacattattattcagagtatatgaat 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41942649 gaaggttgagagaaataaataaattgaaataacataaggtcagagcttgtttgaaatgtcatttcaaagtacaacacattattattcagagtatatgaat 41942748  T
116 atgaattgtgtctatttttccctgatcagcccaaccaacaaaaacgggactccacgttctctgtctcca 184  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41942749 atgaattgtgtctatttttccctgatcagcccaaccaacaaaaacgggactccacgttctctgtctcca 41942817  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University