View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2203_high_5 (Length: 240)
Name: NF2203_high_5
Description: NF2203
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2203_high_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 15 - 224
Target Start/End: Original strand, 14870133 - 14870342
Alignment:
| Q |
15 |
agcaaaggaatggagaaactggaatgagtttggggatgatgtggttaagagggatcagataggaaaggcaataggtttattgatgggaggtggagaagag |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14870133 |
agcaaaggaatggagaaactggaatgagtttggggatgatgtggttaagagggatgagataggaaaggcaataggtttattgatgggaggtggagaagag |
14870232 |
T |
 |
| Q |
115 |
tgtttagaaatgaggaagaaagctaaagcacttagtggtgctgcaaagaaagctatagaggttggtggttcttcatacactgggttgaaacaactaattg |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
14870233 |
tgtttagaaatgaggaagaaagctaaagcacttagtggtgctgcaaagaaagctatagaggttggtggttcttcatacactaagttgaaacaactaattg |
14870332 |
T |
 |
| Q |
215 |
aggagcttaa |
224 |
Q |
| |
|
|||||||||| |
|
|
| T |
14870333 |
aggagcttaa |
14870342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 15 - 224
Target Start/End: Complemental strand, 16908526 - 16908317
Alignment:
| Q |
15 |
agcaaaggaatggagaaactggaatgagtttggggatgatgtggttaagagggatcagataggaaaggcaataggtttattgatgggaggtggagaagag |
114 |
Q |
| |
|
|||||| ||||||||||| |||||||||||||||||||||||||| |||||||| | |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16908526 |
agcaaaagaatggagaaattggaatgagtttggggatgatgtggtgaagagggaggatataggaaaggcaataggtttattgatgggaggtggagaagag |
16908427 |
T |
 |
| Q |
115 |
tgtttagaaatgaggaagaaagctaaagcacttagtggtgctgcaaagaaagctatagaggttggtggttcttcatacactgggttgaaacaactaattg |
214 |
Q |
| |
|
||||||||||||||||| | || ||||||||||||||||||||||||||||||||| ||||||||||||||||| || ||| ||||||| ||||||||| |
|
|
| T |
16908426 |
tgtttagaaatgaggaaaagagttaaagcacttagtggtgctgcaaagaaagctattgaggttggtggttcttcttatactaagttgaaagaactaattg |
16908327 |
T |
 |
| Q |
215 |
aggagcttaa |
224 |
Q |
| |
|
|||||||||| |
|
|
| T |
16908326 |
aggagcttaa |
16908317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University