View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2203_low_4 (Length: 285)
Name: NF2203_low_4
Description: NF2203
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2203_low_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 162; Significance: 2e-86; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 105 - 274
Target Start/End: Complemental strand, 16015597 - 16015428
Alignment:
| Q |
105 |
acatcagcaaatgattgacctgataaatctacattagaatgagagttgtctcttgatgaaccaaattggaagtcacattatgttatttcttgatgaacta |
204 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16015597 |
acatcatcaaatgattgacctgataaatctacattagaatgagagttgtctcttgatgaaccaaattggaagtcacattatgttatttcttgatgaacta |
16015498 |
T |
|
| Q |
205 |
gagttagtgttagattgacacaaactacataacaacgctttccctattagaactccactaaccgatgatg |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
16015497 |
gagttagtgttagattgacacaaactacataacaacgctttccctattagaactccactaaccgctgatg |
16015428 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University