View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2203_low_8 (Length: 217)
Name: NF2203_low_8
Description: NF2203
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2203_low_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 65; Significance: 9e-29; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 65; E-Value: 9e-29
Query Start/End: Original strand, 1 - 69
Target Start/End: Complemental strand, 26245871 - 26245803
Alignment:
| Q |
1 |
ccataggggctttggaaggaagaagctatcgtgcaagggtttctgcaattcaattataaagattttaac |
69 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26245871 |
ccataggggctatggaaggaagaagctatcgtgcaagggtttctgcaattcaattataaagattttaac |
26245803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 134 - 199
Target Start/End: Complemental strand, 26245745 - 26245680
Alignment:
| Q |
134 |
cgcgagtttagaagggattcttctgtgagaagcgatggtgaaggtgggagttgcaggaactgatag |
199 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26245745 |
cgcgagttgagaagggattcttctgtgagaagcgatggtgaaggtgggagttgcaggaactgatag |
26245680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University