View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2204_high_3 (Length: 242)
Name: NF2204_high_3
Description: NF2204
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2204_high_3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 228
Target Start/End: Complemental strand, 52344855 - 52344629
Alignment:
| Q |
1 |
ttattccattctttgaattttgcattgttgaccataagggtatgttgcaaattgaaggctcctatataaacctttgcatttcatgctaataatcacatcc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
52344855 |
ttattccattctttgaattttgcattgttgaccataagggtatgttgcaaattgaaggctcctatataaacctttgcatttcatgccaataatcacatcc |
52344756 |
T |
|
| Q |
101 |
atgcaaatattagttacaacttattacaaacattacaattaattccattttgcaaataatggctttaagttctgttaaaggcttcttttgtttgctatta |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52344755 |
atgcaaatattagttacaacttattacaaacattacaattaattccattttgc-aataatggctttaagttctgttaaaggcttcttttgtttgctatta |
52344657 |
T |
|
| Q |
201 |
attacatgtatgattgggatgaatactt |
228 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
52344656 |
attacatgtatgattgggatgaatactt |
52344629 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University