View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2205_high_17 (Length: 252)
Name: NF2205_high_17
Description: NF2205
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2205_high_17 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 247
Target Start/End: Original strand, 30897261 - 30897506
Alignment:
| Q |
1 |
aaagcttataacatggggttcgacagatgatctaggccaaagttatgtaacgtcgggcaagcacggggtaatgcataaccatatagaacgatattgtctc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30897261 |
aaagcttataacatggggttcgacagatgatctaggccaaagttatgtgacgtccggcaagcacggggtaatgcataaccatatagaacgatattgtctc |
30897360 |
T |
|
| Q |
101 |
cnnnnnnnnngtctgtataccaacattgtataattttatttgtgaaggaaactccagagccgttctctcttccaaatgaagtgtctattgtaaaagctgc |
200 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30897361 |
ctttttttt-gtctgtataccaacattgtataattttatttgtgaaggaaactccagagccgttctctcttccaaatgaagtgtctattgtaaaagctgc |
30897459 |
T |
|
| Q |
201 |
ttctgcgtgggcacattgtgttgctgcgacaggtaacctttgcttct |
247 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
30897460 |
ttctgcgtgggcacattgtgttgccgcgacaggtaacctttgtttct |
30897506 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University