View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2205_high_29 (Length: 201)
Name: NF2205_high_29
Description: NF2205
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2205_high_29 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 151; Significance: 4e-80; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 19 - 185
Target Start/End: Complemental strand, 13153209 - 13153043
Alignment:
| Q |
19 |
ttatagcctccacatcatgattcaatggaaacagaacctacatacattaataatattgtcctcatcagtccataatgtgatcagaaattcataactgatg |
118 |
Q |
| |
|
||||||||| |||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
13153209 |
ttatagccttcacatcttgactcaatggaaacagaacctacatacattaataatattgtcctcatcagtccataatgtgatcagaaattcagaactgatg |
13153110 |
T |
|
| Q |
119 |
aatgcctttcagtgtgatcaatgactttcaagcaaccatgcagagagttctataatcactgaccaca |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13153109 |
aatgcctttcagtgtgatcaatgactttcaagcaaccatgcagagagttctataatcactgaccaca |
13153043 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University