View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2205_low_16 (Length: 294)
Name: NF2205_low_16
Description: NF2205
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2205_low_16 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 19 - 280
Target Start/End: Complemental strand, 46804386 - 46804125
Alignment:
| Q |
19 |
aatacagtatgttttactcaagtaatttacattaaccatcggcatcattcaccgagttctatttggatcgatggcgacggtggagcaacaccgtaagacc |
118 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
46804386 |
aatacagtatgttttactcaagtaattaacattaaccatcggcatcattcaccgagttctatttggatcgatggcgacggaggagcaacaccgtaagacc |
46804287 |
T |
|
| Q |
119 |
accttcgacggtggttggttagcagccaggtctactgaaatcaacttcaccggaattcagctcaccactacccaccctccaacttcctctactcccccgt |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
46804286 |
accttcgacggtggttggttagcagccaggtctactgaaatcaacttcaccggaattcagctcaccactacccaccctccaacttcctccactcccccgt |
46804187 |
T |
|
| Q |
219 |
ggattgaagccgtcgttcccggaacgtaatcttctactttcattctttctttttatcttgtc |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46804186 |
ggattgaagccgtcgttcccggaacgtaatcttctactttcattctttctttttatcttgtc |
46804125 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University