View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2205_low_22 (Length: 250)
Name: NF2205_low_22
Description: NF2205
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2205_low_22 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 48676076 - 48675839
Alignment:
| Q |
1 |
caagtacaagtggagccttaagtcaagcaatgcaagaatacacgtggatccagttacaatattaatctcttgccatgtaggattttatcttcaatcttca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48676076 |
caagtacaagtggagccttaagtcaagcaatgcaagaatacacgtggatccacttacaatattaatctcttgccatgtaggattttatcttcaatcttca |
48675977 |
T |
|
| Q |
101 |
attcaatataaattgtggccaaagtgaagctactaaatatccaagtgcaacaattagcttagctagagacttaaaatgggagggagaatgtctaagttga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48675976 |
attcaatataaattgtggccaaagtgaagctactaaatatccaagtgcaacaattagcttagctagagacttaaaatgggagggagaatgtctaagttga |
48675877 |
T |
|
| Q |
201 |
ggagaattgtaaggcaacaaaaggggaaactttatatt |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48675876 |
ggagaattgtaaggcaacaaaaggggaaactttatatt |
48675839 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University