View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2206_high_14 (Length: 253)
Name: NF2206_high_14
Description: NF2206
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2206_high_14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 18 - 243
Target Start/End: Complemental strand, 38688491 - 38688268
Alignment:
| Q |
18 |
acatgtgcgggaggagccaccgcacagggcctaaaattttagaannnnnnnnatttttctatttcttcttatagatgttcttgatgataaaattctattt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38688491 |
acatgtgcgggaggagccaccgcacagggcgtaaaattttaga---ccccccatttttctatttcttcttatagatgttcttgatgataaaattctattt |
38688395 |
T |
 |
| Q |
118 |
gaggaattgaatgtaagccaagagttttaacaattgaataagttttatgatattgagttctcttaatacattttagtatttgctataatgcatgcatatc |
217 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
38688394 |
gaggaattgaatgtaagccaggagttttaacaattgaataagttttatgatattgagttctcttaatacattttattatttgctataatgcatgcatatc |
38688295 |
T |
 |
| Q |
218 |
ttatagaat-aatatcaactacctttg |
243 |
Q |
| |
|
||||||||| ||||||||||| ||||| |
|
|
| T |
38688294 |
ttatagaataaatatcaactatctttg |
38688268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University