View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2206_high_18 (Length: 242)
Name: NF2206_high_18
Description: NF2206
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2206_high_18 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 11 - 223
Target Start/End: Complemental strand, 43397799 - 43397588
Alignment:
| Q |
11 |
attattctcaccaattaagttaagttcacgtaaactaatcattctcttttttcctaggagattaatgaatatttattaaggtcaaattgatnnnnnnnta |
110 |
Q |
| |
|
|||||||| ||||| |||||||||||||||||||||||||| ||||||||||||| |||||||||||||| | |||||||||||||||||| || |
|
|
| T |
43397799 |
attattcttaccaactaagttaagttcacgtaaactaatcactctcttttttcctgggagattaatgaatttctattaaggtcaaattgatgaaaaa-ta |
43397701 |
T |
|
| Q |
111 |
ttcacattttccactcaatttccttcatttgatgggatgttgaagatatagcattaaaataaattataataaccataggaaagatagatgcattagtgtt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| | |
|
|
| T |
43397700 |
ttcacattttccactcaatttccttcatttgatgggatgttgaagatatagcattaaaataaattataataaccataggaaagatagatgtattagtggt |
43397601 |
T |
|
| Q |
211 |
gctcctttatcta |
223 |
Q |
| |
|
|||||| |||||| |
|
|
| T |
43397600 |
gctcctctatcta |
43397588 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University